You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
yqeL [2019-07-05 11:32:53]
ribosomal silencing factor
Molecular weight
13.16 kDa
Product
ribosomal silencing factor
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
2,642,841 → 2,643,197
The protein
Catalyzed reaction/ biological activity
silences translation by binding to the L14 protein of the large ribosomal subunit and, as a consequence, impairs subunit joining PubMed Protein family
Iojap family (according to Swiss-Prot)Structure
2O5A (from B. halodurans, 65% identity) Interactions
Additional information
the protein is enriched in 45S assembly intermediates that accumulate upon depletion of RbgA PubMed Expression and Regulation
Biological materials
Mutant
MGNA-C500 (yqeL::erm), available at the NBRP B. subtilis, JapanBKE25620 (ΔrsfS::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GTTCATTCACAAATTCCTCC, downstream forward: _UP4_GATCTTGACTTTGGAATGAABKK25620 (ΔrsfS::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GTTCATTCACAAATTCCTCC, downstream forward: _UP4_GATCTTGACTTTGGAATGAA References
Loading